6 Pages Bio

6 Pages Bio

Our goal is to transform our school classroom according to bionics.

The bibliography is the last part of the article

In the final paper, you will research and critically evaluate biomimetic design methodologies, how to identify the functional challenges within a design challenge statement and how to abstract design principles from these natural models to apply to their design solution concepts. Criteria and strategies for research will be assigned and discussed in class. Evidence of research will include a bibliography and summary of relevant findings. Typically, the subsequent critical analysis and interpretation will be in the form of a paper. The overall length of the entire assignment is six pages, plus title page and bibliography. Bibliography will be in MLA style. A statement of intent, summary of research and bibliography always accompanies a project. Acceptable projects are those, which are useful as demonstrations in an LAS educational context. All written work must be in 12-point font, double-spaced with one-inch margins, with a single cover sheet on which you will provide the title, your name and course description. Work not confirming these standards will loose points. Papers/projects without a bibliography automatically fail. A one-page statement of intent (description of topic, relevance, and these statement) and the bibliography will be due two weeks before the actual paper is due. The final paper and the statement of intent are to be uploaded onto O-space (‘submissions’ tab of the course). Hardcopies are no longer accepted.

“Order a similar paper and get 20% DISCOUNT on your FIRST THREE PAPERS with us Use the following coupon “GET20”

 

Short Paper Assignment

Short Paper Assignment

Your assignment this semester is to perform an analysis of one of the groups we have studied from the viewpoint of one or more of the theorists I have introduced this session. The material for your analysis is to be derived from the textbook, films, lectures, and independent research.

First, I want a brief, approximately half-page synopsis of the society, institution, culture, belief system, behavior on which you are going to focus. Next, I want you to analyze one piece of the political, social , economic, and cultural puzzle that is a society from one or two of the theoretical viewpoints discussed in the course. Any of the groups that we have studied is acceptable as a topic. Your analysis must contain data from the lectures, films, text, and from your own independent research. In this assignment, simply agreeing with the text and lectures interpretations is insufficient. You will need to expand your argument beyond the scope of the material presented in the course. Your analysis is expected to be unique. You will not receive a low grade if I disagree with you.

The assignment should be a minimum of approximately three pages of double-spaced type and a maximum of five pages. Intelligent analysis, careful, writing, and good grammar are the basis for your grade. The approximate due date for this assignment is due May 6th.

I will happily look at drafts in email form and you can meet with me in office hours to go over your ideas. It almost always raises the student’s grades if a draft/discussion precedes the final work. I have also posted an outline of the theorists to help guide your analytical choices. Let me know if you have questions!

“Order a similar paper and get 20% DISCOUNT on your FIRST THREE PAPERS with us Use the following coupon “GET20”

 

Discussion-Week4

Discussion-Week4

For this week’s discussion you need to post your thoughts on the following questions.

Per our textbook, there are four key features of capitalism which include the existence of companies, the goal of making a profit, a competitive market, and private property ownership.

How do these four features of capitalism relate to you as an individual residing in the “land of free enterprise.?”

Do you feel that capitalism is fair across the board for small business owners as well as large corporate giants? Explain your thoughts.

“Order a similar paper and get 20% DISCOUNT on your FIRST THREE PAPERS with us Use the following coupon “GET20”

 

Final Documentary Assignment

Final Documentary Assignment

Write a 2-page reflection in a Word document following the APA Style;

  1. List the title of the documentary at the beginning of your assignment.
  2. Briefly summarize the premise of the documentary.
  3. What did you learn from watching it?
  4. How does the content covered impact public health?
  5. Would you recommend the documentary to others? Why or why not?
  6. Anything else you think is important.

“Order a similar paper and get 20% DISCOUNT on your FIRST THREE PAPERS with us Use the following coupon “GET20”

 

Weekly Discussion- Fetal Microchimerism And Women’s Brains

Weekly Discussion- Fetal Microchimerism And Women’s Brains

Many studies show a retention of fetal cells after birth or even male cells in women who have never given birth. This number of cells is miniscule, leading to the term “fetal microchimerism (FMc). Here are some articles about it. What do you think about the link between women with FMc and auto-immune disorders or as it affects transplants?

http://www.bloodjournal.org/content/102/10/3465?sso-checked=true

http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0045592

http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2894651/ (Links to an external site.)

http://www.jimmunol.org/content/164/11/5545.short (Links to an external site.)

http://www.theatlantic.com/health/archive/2014/10/your-babys-leftover-dna-is-making-you-stronger/381140/ (Links to an external site.)

“Order a similar paper and get 20% DISCOUNT on your FIRST THREE PAPERS with us Use the following coupon “GET20”

 

Biology Research. Expert ONLY

Biology Research. Expert ONLY

Typed past tense, double spaced, 12 pt. Times New Roman font with subheadings.

7 cited sources 

Title – short and to the point

  1. Abstract 1 paragraph
  2. Introduction 2 paragraphs – background, history, use, purpose, hypothesis
  3. Materials and Methods- 2 paragraphs- procedure and materials
  4. Results [no paragraph specification] – analyze data, state trends, reasons why
  5. Discussion [only paragraph specification was that it will probably be the longest section]
  6. works cited/bibliography.

“Order a similar paper and get 20% DISCOUNT on your FIRST THREE PAPERS with us Use the following coupon “GET20”

 

Develop A 3 Page Research Paper That Identifies A Toxicant That Causes Reproductive Toxicity.

Develop A 3 Page Research Paper That Identifies A Toxicant That Causes Reproductive Toxicity.

identify a toxicant that causes reproductive toxicity. Develop a research paper that includes the following:

background information on the toxicant, its use, and routes of exposure;

the process by which this toxicant causes reproductive toxicity and the concentration of exposure;

ways exposure to the toxicant might be limited, treated, and/or effects reversed; and

recent research findings (within the last five years) on this toxicant.

The research paper should be a minimum of three pages in length, not including the title and reference pages, and written in APA format with proper in-text citations and references.

The paper should utilize at least three credible sources that include at least one peer reviewed journal article published within the last five years.

 

Safeassign will be used to check for plagiarism 

“Order a similar paper and get 20% DISCOUNT on your FIRST THREE PAPERS with us Use the following coupon “GET20”

 

Microbial Research Paper

Microbial Research Paper

You will pick a microorganism for your paper on pathology or microbe-environment interactions. The organism can not be one of the ones your instructor goes over during lecture listed in the syllabus. Select a pathogen/microbe from current events that is an emerging or reemerging concern to you or people in your area. Provide local epidemiological data/statistics for the organism.

Your paper must include:

  • Introduction to the organism (structure, cell type, morphology, metabolic requirements, natural reservoir, history, etc.)
  • Introduction to the disease(s) caused by the organism (epidemiology, signs, symptoms, etc.) OR introduction to the environmental impact of the organism
  • List and describe factors employed by the organism to assist in its growth, reproduction, culture conditions, host/pathogen interactions and/or virulence. (e.g. nitrogen fixation, symbiotic interactions etc.) Categorize virulence factors by mechanisms of action (Immunity Avoidance, Tissue/Cell Lysis, Colonization/Spread)
  • Discussion of treatment/prevention options for the disease(s) caused by the organism (Antibiotics or other chemotherapeutics given as part of treatment and their mechanisms of action, Vaccines available and type)
  • The paper should be a minimum of 5 pages of relevant and informative material that covers all of the content and requirements listed below and in the rubric. The 5 pages does not include the title and reference pages. The paper should thoroughly inform the reader.
  • APA format. This includes citations and references
  • Title page must have a title, student name, instructor name, course title, and date.
  • No direct quotes; put information into your own words or paraphrase
  • Minimum of three (3) primary and at least two (2) secondary scholarly sources, plus any other references used. You also must include in-text citations.
  • 1 inch margins
  • Double-spaced
  • 12 point, Times New Roman
  • After uploading to Turnitin, your paper will be scored for similarity. Anything above 20% similarity should be worked on further and uploaded again before the due date. Please email your instructor for more help with this.
  • Over 20% similarity and/or no references will result in an automatic zero on the paper.

“Order a similar paper and get 20% DISCOUNT on your FIRST THREE PAPERS with us Use the following coupon “GET20”

 

“Community Health Information” Please Respond To The Following:

“Community Health Information” Please Respond To The Following:

Analyze your state or county/city health department’s website (e.g., dhhs.gov). A Google search of your city’s “health profile” may also yield results. What new information did you learn from your search? Compare and contrast this information to that for another state or county/city. How does your selected health profile compare? Provide related examples based on the communities searched.

“Order a similar paper and get 20% DISCOUNT on your FIRST THREE PAPERS with us Use the following coupon “GET20”

 

Lab Report Genetics

Lab Report Genetics

Objective:

A brief (one or two sentence) statement of the objective or goals of the experiment.

Introduction:

A concise introduction to the problem being investigated. Provide background and references relevant to the experimental system. Should be no longer than one to two pages.

Materials & Methods:

A complete and detailed listing of both materials used and methods employed to complete these experiments.  The idea of this section is to permit anyone who is knowledgeable in science to understand what was done, why it was done, and have sufficient information to reproduce the experiment.

And please put this in your own words.

Results:

In this section you present the results of your experiment. This includes both raw and manipulated data, tables, charts, or graphs. The idea of this section is to present what was observed in the experiment, but not to interpret or discuss the data. Any difficulties that were noted in the course of data collection might be relevant here.

Discussion:

In this section you get your chance to interpret and explain the data that was collected. Does it make sense? Is it what you expected or predicted? If not, why not? List possible sources of errors. You may want to compare your data to that collected by other groups for the same experiment. What kinds of changes  or  suggestions  can  you  make  for  improving  or  changing  this experiment? This is an important part of the lab report.

References:

A minimum of 5 sources for each report. Encyclopedias do not count. You can use a maximum of two web sources (URL’s) but I also want real references to actual primary scientific literature. Find and cite (in proper form at) sources that were helpful in the writing of this report.

  1. 1.1 Forward sequence:

AATAAATCAACTATTCTCTGTTCTTTCATGGGGAGCAGATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGCACGGTACCATAAATACTTGACCACCTGTAGTACATAAAAACCCAATCCACATCAAAACCCCCTCCCCATGCTTACAAGCAAGTACAGCAATCAACCCTCAACTATCACACATCAACTGCAACTCCAAAGCCACCCCTCACCCACTAGGATACCAACAAACCTACCCATCTTTAACAGCACATAGTACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCCCTCAGATAGGGGTCCCTTGACCAACCATCCTCCAAATAAATCAACTATTCTCTGTTCTTTCATGGGGAGCAGATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGCACGGTACCATAAATACTTGACCACCTGTAGTACATAAAAACCCAATCCACATCAAAACCCCCTCCCCATGCTTACAAGCAAGTACAGCAATCAACCCTCAACTATCACACATCAACTGCAACTCCAAAGCCACCCCTCACCCACTAGGATACCAACAAACCTACCCATCTTTAACAGCACATAGTACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCCCTCAGATAGGGGTCCCTTGACCAACCATCCTCCA

1.2 Reverse sequence:

GCTAGGGAGGGGCAACATGGGAGAGAGGGATTGACTGTATGTGCTATGTACGGTAAATGGCTTTATGTACTATGTGCTGTTAAGATGGGTAGGTTTGTTGGTATCCTAGTGGGTGAGGGGTGGCTTTGGAGTTGCAGTTGATGTGTGATAGTTGAGGGTTGATTGCTGTACTTGCTTGTAAGCATGGGGGAGGGGGTTTTGATGTGGATTGGGTTTTTATGTACTACAGGTGGTCAAGTATTTATGGTACCGTGCAATATTCATGGTGGCTGGCAGTAATGTACGAATACATAGCGGTTGTTGATGGGTGAGTCAATACTTGGGTGGTACCAAATCTGCTTCCCCATGAAAGAACAGAGAATAGTTTAAATTACAAAAATTAAGCTTGGGTGCTAATGGTGGGAGTTAAACAA

2. Compare forward and reverse sequences. Open both your forward and reverse sequence files. These should be complements of each other. A fast way to compare these two is to use the BLAST feature of NCBI (GenBank) to BLAST2sequences. This will rapidly align these and show you where they do and do not match. Where they do not match is something you should pay attention two. The base callings routines are not infallible and if there is a discrepancy it is likely because the base was called incorrectly by the software on one strand. You have to step in and make a call as to which strand is correct. Once you have done this for all mismatches the two strands should be perfectly complementary to each other. You will notice that the ends of the two molecules are not matching – each will have 20 bases or so that are not in the other strand. You should be able to explain why that is.
3. Determine your haplogroup by doing a BLAST search. Once you have opened and viewed your DNA sequence, copy and paste your sequence and follow my previous instructions on searching this sequence against all known genetic sequence data on GenBank using the BLAST protocol. (BLAST stands for Basic Local Alignment Search Tool). This will help you to determine your haplogroup. This is an important piece of information and will give you quite a bit to write about. Once you have your haplogroup determined you can research this on the web and find out what it means. I have posted a few articles that discuss the concept of haplogroups. I suggest starting with the Wikipedia entry – it gives a nice short introduction to mitochondrial haplogroups and their distribution worldwide. Also use the URL link I provided on Canvas for determining your haplogroup.

4. Compare your DNA sequence to others. You can open up any of your colleagues data sets (using the same software you used to open and view your sequence data) and compare the D-loop regions. What you will most likely find is that your sequence is different from any other randomly picked sample. Over 400 bp of D-loop sequence you likely see at least a few SNP’s (single nucleotide polymorphisms). This is what allows scientists to use this region to fingerprint individuals using their DNA.

pastedGraphic.png pastedGraphic_1.png pastedGraphic.png pastedGraphic_2.png pastedGraphic_3.png

An easy way to align and compare D-loop sequences is to use a program called Clustal. One of the easiest Clustal alignments can be done on the Dolan DNA Learning Center’s site maintained by the Cold Spring Harbor Laboratories. You can access this BioServer Site by clicking here. Use the Sequence Server (you can enter as a guest or create a free login by registering). Click on Create Sequence and this will allow you to cut and paste sequences into your workspace. You can enter up to 10 sequences to compare. After they are entered you just click on the boxes of the sequences you want to align and then click on “Compare” (with the box reading Align: Clustal W). You will then get a computer alignment of your sequences showing where they are identical and where they are different (colored yellow). This can be printed out and used in your report.

Another useful feature of this site is that you can download and use hundreds of different D-loop sequences to compare to your own. These include ancient DNA samples, modern groups of humans, non-human primates, and even Neanderthal mtDNA D-loop sequences. To access these just click on “Manage Groups” and drop down the window that reads classes. I have included the help file in a separate .pdf file.

5. Phylogenetic Tree. Once your data has been entered and you perform a Clustal Alignment you can easily create a tree diagram that will show visually how you are related to others based on your D-loop sequence. This is called a phylogenetic tree and can be created by clicking on the drop down box that reads Align: Clustal W (next to compare). Select Phylogenetic Tree and hit “Compare.” A tree diagram will be drawn to compare your selected sequences.

Compare to this DNA sequence:

1. Forward sequence:

GAATAATTTAACTATTCTCTGTTCTACATGGGGAGCAGATTGGGTACCACCCAAGTATTGACTTACCCATCAACAACCGCTATGTATCTCGTACATTACTGCCAGCCACCATGAATATTGCACGGTACCATAAATACTTAACCACCTGTAGTACATAAAAACCCAATCCACATCAAAACCCCCTCCCCATGCTTACAAGCAAGTACAGCAATCAACCCTCAACTACCACACATCAACTGCAACTCCAAAGCCACCTCTCACCCACTAGGATACCAACAAACCTACCCACCCTTAACAGTACATAGTACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCCCTCAGATAGGAAAACCCTTGACCAACCATCCTCCAGGGCCGAGGGTAATTTCTTTTGGTTTCATTCTAAAGGCACCATTGTGCGACTTTCTATTTGAACTCAAGGGCAGTTTCTTTATTCCTCTCCCTTTACTCTCGCATCCTTAAAGGAAAAGGAGGTTTCGAATTCCCCCCTGTCTAATTGTTAGAGCACACATAGGCGATCGTTCTATAACTCAGCACAAACCGGGGGGAAAAACATTTCATAGGGGCACTAAGTCTCGGATTCCCCATCTTCCCCCGGGGGCTGGGCGGGTAGCCCCTTGAAAACACTAGACCCTTCGGTGGTAAAAATTGCCTACAACCGAATTAAAAAATGAGAGCCGTTTTTCCTGGC

Reverse sequence:

ATTTTGAGGGGGCTTCTTGGGGGGCGAGTAGGATTGACTCGTGATGTGCTATGTACGGTAATGGCTTTATGTACTATGTACTGTTAAGGGTGGGTAGGTTTGTTGGTATCCTAGTGGGTGAGAGGTGGCTTTGGAGTTGCAGTTGATGTGTGGTAGTTGAGGGTTGATTGCTGTACTTGCTTGTAAGCATGGGGAGGGGGGTTTTGATGTTGGATTGGGTTTTTTATGTACTACAGGTGGTTAAGTATTTTATGGTACCGTGCAATTATTTCATGGGTGGCTGGGCAGTATTGTACGGAGATACCATAGCGGGTTGGTTGGATGGGGTAAAGTCATTAATTTGGGGTGGGTACCCCAAATCTGCTTCCCCCATGAAAAGAAACAGAGAATAAGTTTTAATTTTGGTTTCTTTAGCTTTGGGGTGCTTAATGGGGGGGAGGTTAAAAAACCCCCCCGCCGTTTCCCGGGGGGGGGGGGGGGGGCAACCTTCCCCGGGCCCGGGGGGAAAACTAACCCGTATGGACAGTCTTCCAATCACGTCAAAGTTTAGGTCTTTTTATATTACTTCAATGGGGCTGGGGGACGTTCGGGAAAACGGGTGACCCATTGGGGGGTTAATCACCTTGGGGGATAGTCCGGTGGGGGAGCTGGCCCAAGTGCCCAATATCAACGTGGTGACGGGGGGGTGGGGGGGGGGCGGTGGGGTCTCGAAA

“Order a similar paper and get 20% DISCOUNT on your FIRST THREE PAPERS with us Use the following coupon “GET20”